Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SLC19A2-solute carrier family 19 (thiamine transporter), member 2 Gene
PTXBC018514
New product
Data sheet of SLC19A2-solute carrier family 19 (thiamine transporter), member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC19A2-solute carrier family 19 (thiamine transporter), member 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018514 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC19A2 |
| Origin species: | Human |
| Product name: | SLC19A2-solute carrier family 19 (thiamine transporter), member 2 Gene |
| Size: | 2ug |
| Accessions: | BC018514 |
| Gene id: | 10560 |
| Gene description: | solute carrier family 19 (thiamine transporter), member 2 |
| Synonyms: | TC1; THMD1; THT1; THTR1; TRMA; thiamine transporter 1; high affinity thiamine transporter; reduced folate carrier protein (RFC) like; solute carrier family 19 (thiamine transporter), member 2; thTr-1; solute carrier family 19 member 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatgtgcccggcccggtgtctcggcgggcggcggcggcggcggccactgtgctcctgcggaccgctcgggtccgtcgcgaatgctggttcttgccgaccgcgctgctctgcgcctacggcttcttcgccagcctcaggccgtccgagcccttcctgaccccgtacctgctggggccggacaagaacctgaccgagagggaggaacccaagccagaccgtctccttgtattgaaagtactatggaatgatttcctgatgtgctactcctctcgccctcttctctgctggtctgtgtggtgggccctctctacctgtggctattttcaagttgtgaactacacacagggcctgtgggagaaagtgatgccttctcgctatgctgctatctataatggtggcgtggaggccgtttcaaccttactgggtgctgttgctgtgtttgcagttggttatataaaaatatcctggtcaacttggggagaaatgacattatctctcttttctctcctgattgctgctgcagtgtatatcatggacactgtgggtaacatttgggtgtgctatgcatcctatgttgtcttcagaatcatctacatgttactcatcacgatagcaacttttcaaattgctgcaaacctcagcatggaacgctatgccctagtatttggtgtaaataccttcattgccctggcactgcagacgctgctcactctaattgtggtagatgccagtggccttggattagaaattaccactcagtttttgatctatgccagttattttgcactcatcgctgtggttttcctggccagtggtgcagtcagtgttatgaagaaatgtagaaagctggaagatccacaatcaagttctcaagtaaccacttcataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - aldo-keto reductase family 1, member B1 (aldose reductase) - aldo-keto reductase family 1, member B1 (aldose reductase) - Parkinson disease (autosomal recessive, juvenile) 2, parkin - LanC lantibiotic synthetase component C-like 1 (bacterial) |