Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SLC25A10-solute carrier family 25 (mitochondrial carrier, dicarboxylate transporter), member 10 Gene
PTXBC015797
New product
Data sheet of SLC25A10-solute carrier family 25 (mitochondrial carrier, dicarboxylate transporter), member 10 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC25A10-solute carrier family 25 (mitochondrial carrier, dicarboxylate transporter), member 10 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015797 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC25A10 |
| Origin species: | Human |
| Product name: | SLC25A10-solute carrier family 25 (mitochondrial carrier, dicarboxylate transporter), member 10 Gene |
| Size: | 2ug |
| Accessions: | BC015797 |
| Gene id: | 1468 |
| Gene description: | solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10 |
| Synonyms: | DIC; mitochondrial dicarboxylate carrier; dicarboxylate ion carrier; solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10; solute carrier family 25 member 10 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagccgaggcgcgcgtgtcgcgctggtacttcggggggctggcctcctgcggggccgcctgctgcacgcacccgctggacctgctcaaggtgcatctgcagacgcagcaggaggtgaagctgcgcatgacgggcatggcgctgcgggtggtgcgtaccgacggcatcctggcactctacagcggcctgagcgcctcgctgtgcagacagatgacctactccctgactcggttcgccatctacgagactgtgcgggaccgcgtggccaagggcagccaggggcctctccccttccacgagaaggtgttgctgggctccgtcagcggtttagctggaggcttcgtggggacgcccgcagacttggtcaacgtcaggatgcagaacgacgtgaagctgccccagggtcagcggcgcaactacgcccatgcgctggatggcctgtaccgcgtagctcgtgaagagggtctcaggagactgttctcgggtgcaaccatggcatccagccgaggggccttagtcactgtgggccagctgtcctgctacgaccaggccaagcagctggtccttagcaccgggtacctctctgacaacatcttcactcactttgtcgccagctttattgcagccgctggtgacgagccccctcctcagggtggatgtgccacgttcctgtgccagcccctggatgtgctgaagactcgcctgatgaactccaagggggagtatcagggcgttttccactgcgccgtggagacagcgaagctcgggcctctggccttttacaagggcctcgtcccagctggcatccgcctcatcccccacaccgtgctcacttttgtgtttctggaacagctacgcaaaaactttggcatcaaagtgccatcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) - potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4 - UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5 - leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4 |