Cart 15 Product Products 2 206,15 € (empty)
-
-
1 x MGC9913-hy...113,40 € -
1 x DDOST-doli...121,50 € -
1 x GPR82-G...121,50 € -
1 x LOC440905-...113,40 € -
1 x MGC16075-h...113,40 € -
1 x FGFBP1-fib...113,40 € -
1 x CREB3L2-cA...113,40 € -
1 x SNAPC5-sma...113,40 € -
1 x CERK-ceram...113,40 € -
1 x VPS24-vacu...113,40 € -
1 x DMC1-DMC1...121,50 € -
1 x THEG-Theg...121,50 € -
1 x FETUB-fetu...121,50 € -
1 x MYBPC3...259,07 €
No products
To be determined Shipping
2 206,15 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 15 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 206,15 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 206,15 €
View larger 
SULT1A1-sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 Gene
PTXBC000923
New product
Data sheet of SULT1A1-sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SULT1A1-sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000923 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SULT1A1 |
| Origin species: | Human |
| Product name: | SULT1A1-sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 Gene |
| Size: | 2ug |
| Accessions: | BC000923 |
| Gene id: | 6817 |
| Gene description: | sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 |
| Synonyms: | HAST1/HAST2; P-PST; PST; ST1A1; ST1A3; STP; STP1; TSPST1; sulfotransferase 1A1; P-PST 1; aryl sulfotransferase 1; phenol-sulfating phenol sulfotransferase 1; sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1; thermostable phenol sulfotransferase1; ts-PST; sulfotransferase family 1A member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagctgatccaggacacctcccgcccgccactggagtacgtgaagggggtcccgctcatcaagtactttgcagaggcactggggcccctgcagagcttccaggcccggcctgatgacctgctcatcagcacctaccccaagtccggcactacctgggtaagccagattctggacatgatctaccagggtggtgacctggagaagtgtcaccgagctcccatcttcatgcgggtgcccttccttgagttcaaagccccagggattccctcagggatggagactctgaaagacacaccggccccacgactcctgaagacacacctgcccctggctctgctcccccagactctgttggatcagaaggtcaaggtggtctatgttgcccgcaacgcaaaggatgtggcagtttcctactaccacttctaccacatggccaaggtgcaccctgagcctgggacctgggacagcttcctggagaagttcatggtcggagaagtgtcctacggatcctggtaccagcacgtgcaggagtggtgggagctgagccgcacccaccctgttctctacctcttctatgaagacatgaaggagaacccgaaaagggagattcaaaagatcctggagtttgtggggcactccctgccagaggagaccgtggacttcgtggttcagcacacgtcgttcaaggagatgaagaagaaccctatgaccaactacaccaccgtcccccaggagttcatggaccacagcatctcccccttcatgaggaaaggcatggctggggactggaagaccaccttcaccgtggcgcagaatgagcgcttcgatgcggactatgcggagaagatggcaggctgcagcctcagcttccgctctgagctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phosphatidylinositol-specific phospholipase C, X domain containing 1 - KH domain containing, RNA binding, signal transduction associated 2 - UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 2 - leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2 |