Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
HNRNPC-heterogeneous nuclear ribonucleoprotein C (C1/C2) Gene
PTXBC008364
New product
Data sheet of HNRNPC-heterogeneous nuclear ribonucleoprotein C (C1/C2) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HNRNPC-heterogeneous nuclear ribonucleoprotein C (C1/C2) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008364 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HNRNPC |
| Origin species: | Human |
| Product name: | HNRNPC-heterogeneous nuclear ribonucleoprotein C (C1/C2) Gene |
| Size: | 2ug |
| Accessions: | BC008364 |
| Gene id: | 3183 |
| Gene description: | heterogeneous nuclear ribonucleoprotein C (C1/C2) |
| Synonyms: | HNRNP; HNRPC; SNRPC; heterogeneous nuclear ribonucleoproteins C1/C2; nuclear ribonucleoprotein particle C1 protein; nuclear ribonucleoprotein particle C2 protein; heterogeneous nuclear ribonucleoprotein C (C1/C2) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccagcaacgttaccaacaagacagatcctcgctccatgaactcccgtgtattcattgggaatctcaacactcttgtggtcaagaaatctgatgtggaggcaatcttttcgaagtatggcaaaattgtgggctgctctgttcataagggctttgccttcgttcagtatgttaatgagagaaatgcccgggctgctgtagcaggagaggatggcagaatgattgctggccaggttttagatattaacctggctgcagagccaaaagtgaaccgaggaaaagcaggtgtgaaacgatctgcagcggagatgtacggctcctcttttgacttggactatgactttcaacgggactattatgataggatgtacagttacccagcacgtgtacctcctcctcctcctattgctcgggctgtagtgccctcgaaacgtcagcgtgtatcaggaaacacttcacgaaggggcaaaagtggcttcaattctaagagtggacagcggggatcttccaagtctggaaagttgaaaggagatgaccttcaggccattaagaaggagctgacccagataaaacaaaaagtggattctctcctggaaaacctggaaaaaattgaaaaggaacagagcaaacgagcagtagagatgaagaatgataagtcagaagaggagcagagcagcagctccgtgaagagagatgagactaatgtgaagatggagtctgaggggggtgcagatgactctgctgaggagggggacctactggatgatgatgataatgaagatcggggggatgaccagctggagttgatcaaggatgatgaaaaagaggctgaggaaggagaggatgacagagacagcgccaatggcgaggatgactcttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ORAI calcium release-activated calcium modulator 3 - myeloid differentiation primary response gene (88) - sulfotransferase family, cytosolic, 1C, member 2 - sulfotransferase family, cytosolic, 1B, member 1 |