Cart 26 Product Products 3 494,05 € (empty)
-
-
1 x MGC9913-hy...113,40 € -
1 x DDOST-doli...121,50 € -
1 x GPR82-G...121,50 € -
1 x LOC440905-...113,40 € -
1 x MGC16075-h...113,40 € -
1 x FGFBP1-fib...113,40 € -
1 x CREB3L2-cA...113,40 € -
1 x SNAPC5-sma...113,40 € -
1 x CERK-ceram...113,40 € -
1 x VPS24-vacu...113,40 € -
1 x DMC1-DMC1...121,50 € -
1 x THEG-Theg...121,50 € -
1 x FETUB-fetu...121,50 € -
1 x MYBPC3...259,07 € -
1 x GBAP-gluco...121,50 € -
1 x UBE2O-ubiq...121,50 € -
1 x PACRG-PARK...113,40 € -
1 x AQP5-aquap...113,40 € -
1 x PRSS35-pro...121,50 € -
1 x GBL-G...121,50 € -
1 x CRLS1-card...113,40 € -
1 x SLMO2-slow...113,40 € -
1 x LOC653391-...113,40 € -
1 x PBX2-pre-B...121,50 € -
1 x MGC16025-h...113,40 €
No products
To be determined Shipping
3 494,05 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 26 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 494,05 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 494,05 €
View larger 
MMS19-MMS19 nucleotide excision repair homolog (S. cerevisiae) Gene
PTXBC007298
New product
Data sheet of MMS19-MMS19 nucleotide excision repair homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MMS19-MMS19 nucleotide excision repair homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007298 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MMS19 |
| Origin species: | Human |
| Product name: | MMS19-MMS19 nucleotide excision repair homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC007298 |
| Gene id: | 64210 |
| Gene description: | MMS19 nucleotide excision repair homolog (S. cerevisiae) |
| Synonyms: | MMS19 homolog, cytosolic iron-sulfur assembly component; homolog of yeast MMS19; MMS19-like protein; MMS19-like (MET18 homolog, S. cerevisiae); MMS19 nucleotide excision repair homolog; MMS19 cytosolic iron-sulfur assembly component; MMS19 nucleotide excision repair protein homolog; MET18; MMS19L; hMMS19; MET18 homolog |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcgggagcttttggaactgagctgctgccacagctgccccttttcttccaccgctgctgccaagtgctttgcaggactcctcaacaagcaccctgcagggcagcagctggatgaattcctacagctagctgtggacaaagtggaggctggcctgggctctgggccctgtcgtagtcaggccttcactcttcttctctgggtaacaaaggccctagtgctcagataccatcctctcagctcctgccttacagcccggctcatgggcctcctgagtgacccagaattaggtccagcagcagctgatggcttctctctgctcatgtctgactgcactgatgtgctgactcgtgctggccatgctgaagtgcggatcatgttccgccagcggttcttcacagataatgtgcctgctttggtccagggcttccatgctgctccccaagatgtgaagccaaactacttgaagggtctttctcatgtacttaacaggctgcccaagcctgtactcttgccagagctgcccacgcttctttccttgctgctggaggccctgtcctgccctgactgtgtggtgcagctctccaccctcagctgccttcagcctcttctactggaagcaccccaagtcatgagtcttcacgtggacaccctcgtcaccaagtttctgaacctcagctctagcccttccatggctgtccggatcgccgcactgcagtgcatgcatgctctcactcgcctgcccacccctgtgctgctgccgtacaaaccacaggtgattcgggccttagccaaacccctggatgacaagaagagactggtgcgcaaggaagcagtgtcagccagaggggagtggtttctgttggggagccctggcagctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - StAR-related lipid transfer (START) domain containing 7 - capping protein (actin filament) muscle Z-line, alpha 3 - Fc fragment of IgE, low affinity II, receptor for (CD23) - protein phosphatase 1, catalytic subunit, alpha isoform |