Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GDAP1-ganglioside-induced differentiation-associated protein 1 Gene
PTXBC024939
New product
Data sheet of GDAP1-ganglioside-induced differentiation-associated protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GDAP1-ganglioside-induced differentiation-associated protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC024939 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GDAP1 |
| Origin species: | Human |
| Product name: | GDAP1-ganglioside-induced differentiation-associated protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC024939 |
| Gene id: | 54332 |
| Gene description: | ganglioside-induced differentiation-associated protein 1 |
| Synonyms: | CMT4; CMT4A; CMTRIA; ganglioside-induced differentiation-associated protein 1; Charcot-Marie-Tooth neuropathy 4A; ganglioside induced differentiation associated protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcgtttgaactcaactggagaagtgcctgtccttatccacggggaaaacataatttgtgaggccactcagatcattgattatcttgaacagactttcctggatgaaagaacacccaggttaatgcctgataaagaaagcatgtattacccacgggtacaacattaccgagagctgcttgactccttgccaatggatgcctatacacatggctgcattttacatcctgagttaactgtggactccatgatcccggcttatgcaactacaaggattcgtagccaaattggaaacacagagtctgagctgaagaaacttgctgaagaaaacccagatttacaagaagcatacattgcaaaacagaaacgacttaaatcaaagctgcttgatcatgacaatgtcaagtatttgaagaaaattcttgatgagttggagaaagtcttggatcaggttgaaactgaattgcaaagaagaaatgaagaaaccccagaagagggccagcaaccttggctctgcggtgaatccttcaccctggcagacgtctcactcgctgtcacattgcatcgactgaagttcctggggtttgcaaggagaaactggggaaacggaaagcgaccaaacttggaaacctattacgagcgtgtcttgaagagaaaaacatttaacaaggttttaggacatgtcaacaatatattaatctctgcagtgctgccaacagcattccgggtggccaagaaaagggccccaaaagttcttggcacgacccttgtggttggtttgcttgcaggagtgggatattttgcttttatgcttttcagaaagaggcttggcagcatgatattagcatttagacccagaccaaattatttctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - MMS19 nucleotide excision repair homolog (S. cerevisiae) - StAR-related lipid transfer (START) domain containing 7 - capping protein (actin filament) muscle Z-line, alpha 3 - Fc fragment of IgE, low affinity II, receptor for (CD23) |