Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PTPLA-protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A Gene
PTXBC010353
New product
Data sheet of PTPLA-protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PTPLA-protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010353 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PTPLA |
| Origin species: | Human |
| Product name: | PTPLA-protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A Gene |
| Size: | 2ug |
| Accessions: | BC010353 |
| Gene id: | 9200 |
| Gene description: | protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A |
| Synonyms: | PTPLA; CAP; very-long-chain (3R)-3-hydroxyacyl-CoA dehydratase 1; cementum attachment protein; protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A; very-long-chain (3R)-3-hydroxyacyl-[acyl-carrier protein] dehydratase 1; 3-hydroxyacyl-CoA dehydratase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggcgcctgacggaagcggcggcagcgggcagcggctctcgggctgcaggctgggcagggtcccctcccacgctcctgccgctgtctcccacgtcccccaggtgcgcggccaccatggcgtccagcgacgaggacggcaccaacggcggcgcctcggaggccggcgaggaccgggaggctcccggcaagcggaggcgcctggggttcttggccaccgcctggctcaccttctacgacatcgccatgaccgcggggtggttggttctagctattgccatggtacgtttttatatggaaaaaggaacacacagaggtttatataaaagtattcagaagacacttaaatttttccagacatttgccttgcttgagatagttcactgtttaattggaattgtacctacttctgtgattgtgactggggtccaagtgagttcaagaatctttatggtgtggctcattactcacagtataaaaccaatccagaatgaagagagtgtggtgctttttctggtcgcgtggactgtgacagagatcactcgctattccttctacacattcagccttcttgaccacttgccatacttcattaaatgggccagatataatttttttatcatcttatatcctgttggagttgctggtgaacttcttacaatatacgctgccttgccgcatgtgaagaaaacaggaatgttttcaataagacttcctaacaaatacaatgtctcttttgactactattattttcttcttataaccatggcatcatatatacctttgtttccacaactctattttcatatgttacgtcaaagaagaaaggtgcttcatggagaggtgattgtagaaaaggatgattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase) - NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase) - NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase) - solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6 |