Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PBLD-phenazine biosynthesis-like protein domain containing Gene
PTXBC009738
New product
Data sheet of PBLD-phenazine biosynthesis-like protein domain containing Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PBLD-phenazine biosynthesis-like protein domain containing Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009738 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PBLD |
| Origin species: | Human |
| Product name: | PBLD-phenazine biosynthesis-like protein domain containing Gene |
| Size: | 2ug |
| Accessions: | BC009738 |
| Gene id: | 64081 |
| Gene description: | phenazine biosynthesis-like protein domain containing |
| Synonyms: | HEL-S-306; MAWBP; MAWDBP; phenazine biosynthesis-like domain-containing protein; MAWD-binding protein; epididymis secretory protein Li 306; phenazine biosynthesis like protein domain containing |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagcttcctattttcatagcagatgcattcacagcaagagcatttcgtgggaatcctgctgctgtttgcctcctagaaaatgaattggatgaagacatgcatcagaaaattgcaagggagatgaacctctctgaaactgcttttatccgaaaactgcacccgacagacaactttgcacaaagttcctgctttggactgagatggtttacaccagcgagtgaggtcccactctgtggccatgccaccctggcttctgcagctgtgctgtttcacaaaataaaaaacatgaatagcacgctcacgtttgtcactctgagtggagaactaagggccagacgagcagaggacggcatcgtcctggacttgcctctttatccagcccacccccaggacttccatgaagtagaggacttgataaagactgccataggcaacacactggtccaggacatctgttattctccagatacccaaaagctcctcgtccgcctcagtgacgtttacaacaggtcgtttctggagaacctgaaagtgaacacggagaatctgctgcaagttgaaaacacagggaaggtgaaagggcttattcttacccttaaaggagagcctggtgggcagacccaagcatttgacttttactcaagatattttgcaccgtgggttggtgtggctgaagacccagtgacagggtctgcacacgctgttctcagcagctactggtcccagcatctggggaagaaagaaatgcatgcttttcagtgttcccaccgaggaggagagctgggaatttcccttcgtccagacggaagggttgacattagaggaggtgcagctgttgttttagagggcacactgacagcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 7, member 6 opposite strand - SH3 domain containing, Ysc84-like 1 (S. cerevisiae) - calcium channel, voltage-dependent, gamma subunit 4 - ST3 beta-galactoside alpha-2,3-sialyltransferase 6 |