Cart 6 Product Products 1 054,18 € (empty)
-
1 x C1orf49-ch...113,40 € -
-
1 x Ghrelin...474,00 € -
1 x C17orf66-c...113,40 € -
1 x C7orf11-ch...113,40 € -
1 x PELO-pelot...121,50 €
No products
To be determined Shipping
1 054,18 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 6 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 054,18 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 054,18 €
View larger 
VPS37B-vacuolar protein sorting 37 homolog B (S. cerevisiae) Gene
PTXBC005882
New product
Data sheet of VPS37B-vacuolar protein sorting 37 homolog B (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about VPS37B-vacuolar protein sorting 37 homolog B (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005882 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | VPS37B |
| Origin species: | Human |
| Product name: | VPS37B-vacuolar protein sorting 37 homolog B (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC005882 |
| Gene id: | 79720 |
| Gene description: | vacuolar protein sorting 37 homolog B (S. cerevisiae) |
| Synonyms: | VPS37B, ESCRT-I subunit; ESCRT-I complex subunit VPS37B; vacuolar protein sorting-associated protein 37B; hVps37B; vacuolar protein sorting 37 homolog B; vacuolar protein sorting 37B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgggcgccgggagcgaagcccggttcgccgggctgtcgctggtgcagctcaacgagctgctggaggacgagggccagctgacggagatggtgcagaagatggaggagacacagaatgttcagcttaacaaagaaatgacacttgccagcaaccggagcctggcagaaggaaaccttttgtaccagccccagctggacacgttgaaagcacgcttgacccagaaataccaggaactccaggttctctttgaagcctatcagataaagaagaccaaattagacagacagtctagcagtgcttccttggagaccctgttagcacttcttcaggcagaaggggccaagattgaggaagacactgagaacatggcagagaagtttctggatggagaacttcctctggattccttcattgatgtctatcagagcaaacggaaactggcccacatgcgacgggtgaaaatcgagaagctccaggagatggtcctaaaggggcagagactcccacaggccctggccccgctgccccccaggctgcccgaactggcacctaccgccccccttccctaccctgccccagaggccagtgggcctcctgccgttgcacctcggcgcatcccccccccaccacccccggtgcctgcgggacgcttagccaccccgtttactgcggccatgagttcgggacaggccgtgccgtacccaggattacagtgcccgcccctgcccccccgcgtgggcctccccactcagcaaggattctcttcgcagttcgtgtccccatatccgccacctctccctcagagacccccgccccggctccctccacaccagccgggtttcatcctccagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cyclin-dependent kinase 5, regulatory subunit 1 (p35) - cyclin-dependent kinase 5, regulatory subunit 1 (p35) - Fc fragment of IgG, low affinity IIb, receptor (CD32) - phytanoyl-CoA 2-hydroxylase interacting protein-like |