Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of FHL1-four and a half LIM domains 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FHL1-four and a half LIM domains 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010998 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FHL1 |
| Origin species: | Human |
| Product name: | FHL1-four and a half LIM domains 1 Gene |
| Size: | 2ug |
| Accessions: | BC010998 |
| Gene id: | 2273 |
| Gene description: | four and a half LIM domains 1 |
| Synonyms: | FHL-1; FHL1A; FHL1B; FLH1A; KYOT; RBMX1A; RBMX1B; SLIM; SLIM-1; SLIM1; SLIMMER; XMPMA; four and a half LIM domains protein 1; LIM protein SLIMMER; four-and-a-half Lin11, Isl-1 and Mec-3 domains 1; skeletal muscle LIM-protein 1; four and a half LIM domains 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggagaagtttgactgccactactgcagggatcccttgcaggggaagaagtatgtgcaaaaggatggccaccactgctgcctgaaatgctttgacaagttctgtgccaacacctgtgtggaatgccgcaagcccatcggtgcggactccaaggaggtgcactataagaaccgcttctggcatgacacctgcttccgctgtgccaagtgccttcaccccttggccaatgagacctttgtggccaaggacaacaagatcctgtgcaacaagtgcaccactcgggaggactcccccaagtgcaaggggtgcttcaaggccattgtggcaggagatcaaaacgtggagtacaaggggaccgtctggcacaaagactgcttcacctgtagtaactgcaagcaagtcatcgggactggaagcttcttccctaaaggggaggacttctactgcgtgacttgccatgagaccaagtttgccaagcattgcgtgaagtgcaacaaggccatcacatctggaggaatcacttaccaggatcagccctggcatgccgattgctttgtgtgtgttacctgctctaagaagctggctgggcagcgtttcaccgctgtggaggaccagtattactgcgtggattgctacaagaactttgtggccaagaagtgtgctggatgcaagaaccccatcactgggtttggtaaaggctccagtgtggtggcctatgaaggacaatcctggcacgactactgcttccactgcaaaaaatgctccgtgaatctggccaacaagcgctttgttttccaccaggagcaagtgtattgtcccgactgtgccaaaaagctgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RAS, dexamethasone-induced 1 - four and a half LIM domains 5 - E2F-associated phosphoprotein - heme oxygenase (decycling) 1 |