Cart 14 Product Products 1 757,99 € (empty)
-
1 x ZNF70-zinc...121,50 € -
1 x C14orf79-c...113,40 € -
1 x EGR3-early...121,50 € -
1 x RP11-265F1...121,50 € -
-
1 x TPD52-tumo...113,40 € -
-
-
1 x C11orf67-c...113,40 € -
1 x CALML3-cal...113,40 € -
1 x BNIP3L-BCL...113,40 € -
1 x MYH4...259,07 € -
1 x CXCL16-che...121,50 € -
No products
To be determined Shipping
1 757,99 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 14 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 757,99 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 757,99 €
View larger 
Data sheet of CD40-CD40 molecule, TNF receptor superfamily member 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CD40-CD40 molecule, TNF receptor superfamily member 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012419 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CD40 |
| Origin species: | Human |
| Product name: | CD40-CD40 molecule, TNF receptor superfamily member 5 Gene |
| Size: | 2ug |
| Accessions: | BC012419 |
| Gene id: | 958 |
| Gene description: | CD40 molecule, TNF receptor superfamily member 5 |
| Synonyms: | CD40 molecule; CD40 molecule, TNF receptor superfamily member 5; B cell surface antigen CD40; Bp50; CDW40; TNFRSF5; p50; tumor necrosis factor receptor superfamily member 5; B cell-associated molecule; CD40L receptor |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggttcgtctgcctctgcagtgcgtcctctggggctgcttgctgaccgctgtccatccagaaccacccactgcatgcagagaaaaacagtacctaataaacagtcagtgctgttctttgtgccagccaggacagaaactggtgagtgactgcacagagttcactgaaacggaatgccttccttgcggtgaaagcgaattcctagacacctggaacagagagacacactgccaccagcacaaatactgcgaccccaacctagggcttcgggtccagcagaagggcacctcagaaacagacaccatctgcacctgtgaagaaggctggcactgtacgagtgaggcctgtgagagctgtgtcctgcaccgctcatgctcgcccggctttggggtcaagcagattgctacaggggtttctgataccatctgcgagccctgcccagtcggcttcttctccaatgtgtcatctgctttcgaaaaatgtcacccttggacaagctgtgagaccaaagacctggttgtgcaacaggcaggcacaaacaagactgatgttgtctgtggtccccaggatcggctgagagccctggtggtgatccccatcatcttcgggatcctgtttgccatcctcttggtgctggtctttatcaaaaaggtggccaagaagccaaccaataaggccccccaccccaagcaggaaccccaggagatcaattttcccgacgatcttcctggctccaacactgctgctccagtgcaggagactttacatggatgccaaccggtcacccaggaggatggcaaagagagtcgcatctcagtgcaggagagacagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - caspase 3, apoptosis-related cysteine peptidase - family with sequence similarity 113, member B - family with sequence similarity 131, member C - family with sequence similarity 131, member A |