Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NUFIP1-nuclear fragile X mental retardation protein interacting protein 1 Gene
PTXBC017745
New product
Data sheet of NUFIP1-nuclear fragile X mental retardation protein interacting protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NUFIP1-nuclear fragile X mental retardation protein interacting protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017745 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NUFIP1 |
| Origin species: | Human |
| Product name: | NUFIP1-nuclear fragile X mental retardation protein interacting protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC017745 |
| Gene id: | 26747 |
| Gene description: | nuclear fragile X mental retardation protein interacting protein 1 |
| Synonyms: | NUFIP1, FMR1 interacting protein 1; NUFIP; bA540M5.1; nuclear fragile X mental retardation-interacting protein 1; nuclear FMRP-interacting protein 1; nuclear fragile X mental retardation protein interacting protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcatgctcctggcatgaagaagatcaagttagacactccagaggaaattgcacggtggagggaagaaagaaggaaaaactatccaactctggccaatattgaaaggaagaagaagttaaaacttgaaaaggagaagagaggagcagtattgacaacaacacaatatggcaagatgaaggggatgtccagacattcacaaatggcaaagatcagaagtcctggcaagaatcacaaatggaaaaacgacaattctagacagagagcagtcactggatcaggcagtcacttgtgtgatttgaagctagaaggtccaccggaggcaaatgcagatcctcttggtgttttgataaacagtgattctgagtctgataaggaggagaaaccacaacattctgtgatacccaaggaagtgacaccagccctatgctcactaatgagtagctatggcagtctttcagggtcagagagtgagccagaagaaactcccatcaagactgaagcagacgttttggcagaaaaccaggttcttgatagcagtgctcctaagagtccaagtcaagatgttaaagcaactgttagaaatttttcagaagccaagagtgagaaccgaaagaaaagctttgaaaaaacaaaccctaagaggaaaaaagattatcacaactatcaaacgttattcgaaccaagaacacaccatccatatctcttggaaatgcttctagctccggacattcgacatgaaagaaatgtgattttgcagtgtgttcggtacatcattaaaaaagacttttttggactggatactaattctgcgaaaagtaaagatgtatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta - melanoma antigen family A, 1 (directs expression of antigen MZ2-E) - menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis) - UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4 |