Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of SF3B3-splicing factor 3b, subunit 3, 130kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SF3B3-splicing factor 3b, subunit 3, 130kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009780 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SF3B3 |
| Origin species: | Human |
| Product name: | SF3B3-splicing factor 3b, subunit 3, 130kDa Gene |
| Size: | 2ug |
| Accessions: | BC009780 |
| Gene id: | 23450 |
| Gene description: | splicing factor 3b, subunit 3, 130kDa |
| Synonyms: | RSE1; SAP130; SF3b130; STAF130; splicing factor 3B subunit 3; SAP 130; pre-mRNA splicing factor SF3b, 130 kDa subunit; spliceosome-associated protein 130 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtttctgtacaacttaaccttgcagagagccactggcatcagctttgccattcatggaaacttttctggaaccaaacaacaagaaattgttgtttcccgtgggaagatcttggagctgcttcgcccagaccccaacactggcaaagtacataccctactcactgtggaagtattcggtgttatccggtcactcatggcctttaggctgacaggtggcaccaaagactacattgtagttggcagtgactctggtcgaattgttattttggaataccagccatctaagaatatgtttgagaagattcaccaagaaacctttggcaagagtggatgccgtcgcatcgttcctggccagttcttagctgtggatcccaaagggcgagccgttatgattagtgccattgagaaacagaaattggtgtatattttgaacagagatgctgcagcccgacttaccatttcatctcccctggaagcccacaaagcaaacactttagtgtatcatgtagttggagtagatgtcggatttgaaaatccaatgtttgcttgtctggaaatggattatgaggaagcagacaatgatccaacaggggaagcagcagctaatacccagcagacacttactttctatgagctagaccttggtttaaatcatgtggtccgaaaatacagtgaacctttggaggaacacggcaacttccttattacagttccaggagggtcagatggtccaagtggagtactgaacctgagtcccccattccccaaagccatccctgcattgatatgtcttgactctcctgtctacttttgcacacacccttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - steroidogenic acute regulatory protein - NmrA-like family domain containing 1 - coagulation factor XII (Hageman factor) - peroxisomal membrane protein 3, 35kDa |