Cart 10 Product Products 1 473,35 € (empty)
-
1 x RELT-RELT...121,50 € -
1 x LOC440461-...113,40 € -
-
1 x Phospho-My...259,07 € -
1 x SENP3...259,07 € -
1 x TALDO1-tra...121,50 € -
-
1 x PGK1-phosp...121,50 € -
1 x RRM2B-ribo...121,50 € -
1 x PHCA-phyto...121,50 €
No products
To be determined Shipping
1 473,35 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 10 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 473,35 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 473,35 €
Data sheet of TMEM106B-transmembrane protein 106B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMEM106B-transmembrane protein 106B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC033901 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMEM106B |
| Origin species: | Human |
| Product name: | TMEM106B-transmembrane protein 106B Gene |
| Size: | 2ug |
| Accessions: | BC033901 |
| Gene id: | 54664 |
| Gene description: | transmembrane protein 106B |
| Synonyms: | transmembrane protein 106B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggaaagtctctttctcatttgcctttgcattcaagcaaagaagatgcttatgatggagtcacatctgaaaacatgaggaatggactggttaatagtgaagtccataatgaagatggaagaaatggagatgtctctcagtttccatatgtggaatttacaggaagagatagtgtcacctgccctacttgtcagggaacaggaagaattcctagggggcaagaaaaccaactggtggcattgattccatatagtgatcagagattaaggccaagaagaacaaagctgtatgtgatggcttctgtgtttgtctgtctactcctttctggattggctgtgtttttccttttccctcgctctatcgacgtgaaatacattggtgtaaaatcagcctatgtcagttatgatgttcagaagcgtacaatttatttaaatatcacaaacacactaaatataacaaacaataactattactctgtcgaagttgaaaacatcactgcccaagttcaattttcaaaaacagttattggaaaggcacgcttaaacaacataaccattattggtccacttgatatgaaacaaattgattacacagtacctaccgttatagcagaggaaatgagttatatgtatgatttctgtactctgatatccatcaaagtgcataacatagtactcatgatgcaagttactgtgacaacaacatactttggccactctgaacagatatcccaggagaggtatcagtatgtcgactgtggaagaaacacaacttatcagttggggcagtctgaatatttaaatgtacttcagccacaacagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - armadillo repeat containing 1 - golgi phosphoprotein 3-like - vestigial like 4 (Drosophila) - aquaporin 3 (Gill blood group) |