Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of HEL308-DNA helicase HEL308 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HEL308-DNA helicase HEL308 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011863 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HEL308 |
| Origin species: | Human |
| Product name: | HEL308-DNA helicase HEL308 Gene |
| Size: | 2ug |
| Accessions: | BC011863 |
| Gene id: | 113510 |
| Gene description: | DNA helicase HEL308 |
| Synonyms: | DNA helicase HEL308; HEL308; helicase POLQ-like; POLQ-like helicase; mus308-like helicase; helicase, POLQ-like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatgaatgtggttcccgcatccgccggcgggtgtctctccccaaaaggaaccgtccaagcttggggtgtatttttggcgctcccaccgcggccgagctcgagcccggagatgaggggaaagaggaggaggaaatggtggctgagaacaggaggcggaaaaccgcgggcgtactgccggttgaggtacagccccttctactctcagattccccggaatgtctcgtccttggaggtggtgatacaaacccggacctcctacgtcacatgcccactgacagaggggtgggagaccagcctaatgacagtgaagtggacatgtttggtgactatgatagctttactgaaaactcctttatagctcaagttgacgacctggaacaaaaatatatgcaactccctgaacataagaaacatgctacagactttgccactgaaaatctttgctcggaaagtatcaaaaacaaactcagcattactaccataggcaaccttactgaattacaaactgataagcacacagagaaccagagtggatatgaaggtgtcactattgaacctggagctgatcttttgtatgatgtaccttcctcacaggctatatactttgaaaatttgcagaactcttcaaatgatttgggtgatcattctatgaaagaaagggattggaagtcatcctctcacaacactgtgaatgaggaactgccccataattgcatagagcaaccccagcaaaatgatgagtcctcttccaaagtcagaactagttcagatatgaacaggagaaaaagtattaaagatcatctaaaaatgccatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tropomyosin 1 (alpha) - exosome component 7 - zinc finger protein 2 - zinc finger protein 2 |