PTXBC009825
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC009825 |
Product type: | DNA & cDNA |
Ncbi symbol: | DHRS12 |
Origin species: | Human |
Product name: | DHRS12-dehydrogenase/reductase (SDR family) member 12 Gene |
Size: | 2ug |
Accessions: | BC009825 |
Gene id: | 79758 |
Gene description: | dehydrogenase/reductase (SDR family) member 12 |
Synonyms: | SDR40C1; dehydrogenase/reductase SDR family member 12; dehydrogenase/reductase (SDR family) member 12; short-chain dehydrogenase/reductase family 40C member 1; dehydrogenase/reductase 12 |
Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
Orf sequence: | atgaatctgcatgtaaagactttgtccctcatgacttggaggtccagattcctggaagagtctttttggtcactggaggaaacagcggcattggcaaagcaactgcccttgaaatcgccaagcgagaacatttttctgcacattgtggacttgtctgatcccaagcaaatctggaaatttgttgaaaatttcaagcaggaacataaactccatgttctgatcaataatgcaggttgcatggtcaataaaagagagctcacagaagatggacttgaaaaaaactttgctgccaatactctgggtgtgtacattctcacgaccggcctgatccctgtgctggagaaagaacacgacccccgagtgataaccgtctcctcaggaggaatgttggttcagaaactgaacaccaatgatctccagtccgaaagaacaccatttgatggaactatggtctatgcacaaaacaagaggcagcaagtggttctgacggagcggtgggcccaagggcacccggccatccatttttcttccatgcatcctggctgggccgacaccccagacaggaatgagcaggagctgaggaaggtagtgggagaggcccagactgcctcaccactccccaggtttttggaaataatgatgcatgaaggtaaatgccagccacaaggacacagctcgaatgatctggaagcgtgttggagcagcggtggaggggagcagaattctcttccggattggcctcaccaactccatgacctcaggcagctcacctgggctctctgcagctctttcctcctctacaaacaagggaactga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20℃ |
Delivery condition: | Blue Ice |
Related products: | - family with sequence similarity 164, member C - family with sequence similarity 18, member B2 - CD40 molecule, TNF receptor superfamily member 5 - caspase 3, apoptosis-related cysteine peptidase |