Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of OTUB1-OTU domain, ubiquitin aldehyde binding 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about OTUB1-OTU domain, ubiquitin aldehyde binding 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010368 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | OTUB1 |
| Origin species: | Human |
| Product name: | OTUB1-OTU domain, ubiquitin aldehyde binding 1 Gene |
| Size: | 2ug |
| Accessions: | BC010368 |
| Gene id: | 55611 |
| Gene description: | OTU domain, ubiquitin aldehyde binding 1 |
| Synonyms: | ubiquitin-specific-processing protease OTUB1; deubiquitinating enzyme OTUB1; ubiquitin thioesterase OTUB1; HSPC263; OTB1; OTU1; OTU domain, ubiquitin aldehyde binding 1; OTU domain-containing ubiquitin aldehyde-binding protein 1; OTU-domain Ubal-binding 1; otubain-1; ubiquitin-specific protease otubain 1; OTU deubiquitinase, ubiquitin aldehyde binding 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcggaggaacctcagcagcagaagcaggagccgctgggcagcgactccgaaggtgttaactgtctggcctatgatgaagccatcatggctcagcaggaccgaattcagcaagagattgctgtgcagaaccctctggtgtcagagcggctggagctctcggtcctatacaaggagtgtgctgaagatgacaacatctatcaacagaagatcaaggacctccacaaaaagtactcgtacatccgcaagaccaggcctgacggcaactgtttctatcgggctttcggattctcccacttggaggcactgctggatgacagcaaggagttgcagcggttcaaggctgtgtctgccaagagcaaggaagacctggtgtcccagggcttcactgaattcacaattgaggatttccacaacacgttcatggacctgattgagcaggtggagaagcagacctctgtcgccgacctgctggcctccttcaatgaccagagcacctccgactaccttgtggtctacctgcggctgctcacctcgggctacctgcagcgcgagagcaagttcttcgagcacttcatcgagggtggacggactgtcaaggagttctgccagcaggaggtggagcccatgtgcaaggagagcgaccacatccacatcattgcgctggcccaggccctcagcgtgtccatccaggtggagtacatggaccgcggcgagggcggcaccaccaatccgcacatcttccctgagggctccgagcccaaggtctaccttctctaccggcctggacactacgatatcctctacaaatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - procollagen C-endopeptidase enhancer 2 - chromosome 14 open reading frame 104 - chromosome 14 open reading frame 172 - armadillo repeat containing, X-linked 6 |