Cart 4 Product Products 465,87 € (empty)
-
1 x TSSC4-tumo...121,50 € -
1 x ZC3H7A-zin...113,40 € -
1 x AKR7A2-ald...121,50 € -
No products
To be determined Shipping
465,87 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 465,87 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 465,87 €
Data sheet of SNAI2-snail homolog 2 (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SNAI2-snail homolog 2 (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014890 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SNAI2 |
| Origin species: | Human |
| Product name: | SNAI2-snail homolog 2 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC014890 |
| Gene id: | 6591 |
| Gene description: | snail homolog 2 (Drosophila) |
| Synonyms: | zinc finger protein SNAI2; SLUGH1; SNAIL2; WS2D; neural crest transcription factor SLUG; protein snail homolog 2; slug (chicken homolog), zinc finger protein; snail family zinc finger 2; snail homolog 2; snail family transcriptional repressor 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccgcgctccttcctggtcaagaagcatttcaacgcctccaaaaagccaaactacagcgaactggacacacatacagtgattatttccccgtatctctatgagagttactccatgcctgtcataccacaaccagagatcctcagctcaggagcatacagccccatcactgtgtggactaccgctgctccattccacgcccagctacccaatggcctctctcctctttccggatactcctcatctttggggcgagtgagtccccctcctccatctgacacctcctccaaggaccacagtggctcagaaagccccattagtgatgaagaggaaagactacagtccaagctttcagacccccatgccattgaagctgaaaagtttcagtgcaatttatgcaataagacctattcaactttttctgggctggccaaacataagcagctgcactgcgatgcccagtctagaaaatctttcagctgtaaatactgtgacaaggaatatgtgagcctgggcgccctgaagatgcatattcggacccacacattaccttgtgtttgcaagatctgcggcaaggcgttttccagaccctggttgcttcaaggacacattagaactcacacgggggagaagcctttttcttgccctcactgcaacagagcatttgcagacaggtcaaatctgagggctcatctgcagacccattctgatgtaaagaaataccagtgcaaaaactgctccaaaaccttctccagaatgtctctcctgcacaaacatgaggaatctggctgctgtgtagcacactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phospholipase A2, group XV - four and a half LIM domains 1 - RAS, dexamethasone-induced 1 - four and a half LIM domains 5 |