PTXBC030643
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC030643 |
Product type: | DNA & cDNA |
Ncbi symbol: | WBSCR28 |
Origin species: | Human |
Product name: | WBSCR28-Williams-Beuren syndrome chromosome region 28 Gene |
Size: | 2ug |
Accessions: | BC030643 |
Gene id: | 135886 |
Gene description: | Williams-Beuren syndrome chromosome region 28 |
Synonyms: | Williams-Beuren syndrome chromosomal region 28 protein; Williams-Beuren syndrome critical region 28; Williams-Beuren syndrome chromosome region 28 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggaggcccttcctccagtcagatccagccttttggggaacctgttgcaggttacgaggctctcagtgctgttggttcagaaccgagatcacctctataatttcctgctcctcaagatcaacctcttcaaccactgggtgtcagggctggcccaggaggcccgggggtcctgtaactggcaggcccacctacccctgggagctgcagactgccccctgggccaggctctccgggctgggctggctctgatacaggtccccgtatggctggtgctacagggacccaggctgatgtgggctggcatgtggggcagcaccaagggcctgggcctggccttgctcagtgcctgggagcagctgggcctgtctgtggccatctggacagatctgtttttgtcatgtctgcacggcctgatgttggtggccttgctcttggtggtagtgacctggagggtgtgtcagaagtcccactgcttccgactgggcaggcagctcagtaaggccttgcaagtgaactgcgtggtaaggaagctcctggtacagctgagacgtctgtattggtgggtggagactatgactgccctcacctcctggcacctggcctatctcatcacttggaccacctgcctggcctcccacctgctgcaggctgcctttgagcacacgacccagctggccgaggcccaggaggttgaaccccaggaggtctcagggtcttccttgctgccctcactgtctgcgtcctcggactcagagtctggaacagttttgccagagcaagaaactcccagagaataa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - family with sequence similarity 92, member A1 - dehydrogenase/reductase (SDR family) member 12 - family with sequence similarity 164, member C - family with sequence similarity 18, member B2 |