Cart 38 Product Products 5 310,76 € (empty)
-
1 x CLEC4E-C-t...113,40 € -
1 x RLBP1L2-re...121,50 € -
-
1 x IFRD2-inte...121,50 € -
1 x IFNA6-inte...113,40 € -
-
1 x CALM1-calm...113,40 € -
1 x OBFC2A-oli...113,40 € -
1 x Vaspin594,00 € -
1 x SUMF2-sulf...113,40 € -
1 x IFNA4-inte...113,40 € -
-
1 x IHPK2-inos...121,50 € -
1 x CCNJL-cycl...121,50 € -
1 x LEF1-lymph...121,50 € -
1 x HBEGF-hepa...113,40 € -
-
-
1 x HCCS-holoc...121,50 € -
1 x AP1S3-adap...113,40 € -
1 x SH3BGRL2-S...113,40 € -
1 x IDI1-isope...113,40 € -
-
1 x IFNA13-int...113,40 € -
-
1 x AP1S2-adap...113,40 € -
1 x ABHD14A-ab...121,50 € -
-
1 x AP2M1-adap...121,50 € -
1 x HGF-hepato...113,40 € -
1 x CCNC-cycli...121,50 € -
-
1 x ATPBD3...259,07 € -
-
1 x CCNC-cycli...121,50 € -
-
-
1 x HEXIM1-hex...121,50 €
No products
To be determined Shipping
5 310,76 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 38 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 5 310,76 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 5 310,76 €
Data sheet of TMEM101-transmembrane protein 101 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMEM101-transmembrane protein 101 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007438 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMEM101 |
| Origin species: | Human |
| Product name: | TMEM101-transmembrane protein 101 Gene |
| Size: | 2ug |
| Accessions: | BC007438 |
| Gene id: | 84336 |
| Gene description: | transmembrane protein 101 |
| Synonyms: | transmembrane protein 101 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgtcgaagataggttcgagacggtggatgttgcagctgatcatgcagttgggttcggtgctgctcacacgctgccccttttggggctgcttcagccagctcatgctgtacgctgagagggctgaggcacgccggaagcccgacatcccagtgccttacctgtatttcgacatgggggcagccgtgctgtgcgctagtttcatgtcctttggcgtgaagcggcgctggttcgcgctgggggccgcactccaattggccattagcacctacgccgcctacatcgggggctacgtccactacggggactggctgaaggtccgtatgtactcgcgcacagttgccatcatcggcggctttcttgtgttggccagcggtgctggggagctgtaccgccggaaacctcgcagccgctccctgcagtccaccggccaggtgttcctgggtatctacctcatctgtgtggcctactcactgcagcacagcaaggaggaccggctggcgtatctgaaccatctcccaggaggggagctgatgatccagctgttcttcgtgctgtatggcatcctggccctggcctttctgtcaggctactacgtgaccctcgctgcccagatcctggctgtactgctgccccctgtcatgctgctcattgatggcaatgttgcttactggcacaacacgcggcgtgttgagttctggaaccagatgaagctccttggagagagtgtgggcatcttcggaactgctgtcatcctggccactgatggctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - unc-50 homolog (C. elegans) - transmembrane protein 187 - 5'-nucleotidase, ecto (CD73) - transmembrane protein 41A |