Cart 4 Product Products 952,26 € (empty)
-
1 x ABCA9-ATP-...113,40 € -
1 x ABHD13-abh...113,40 € -
-
1 x AMIGO1-adh...121,50 €
No products
To be determined Shipping
952,26 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 952,26 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 952,26 €
Data sheet of HHIPL2-HHIP-like 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HHIPL2-HHIP-like 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015201 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HHIPL2 |
| Origin species: | Human |
| Product name: | HHIPL2-HHIP-like 2 Gene |
| Size: | 2ug |
| Accessions: | BC015201 |
| Gene id: | 79802 |
| Gene description: | HHIP-like 2 |
| Synonyms: | KIAA1822L; HHIP-like protein 2; hedgehog interacting protein-like 2; HHIP like 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtggcccaagatcctcagggctgcctgcagctctgcctgagcgaggtggccaacgggctgaggaaccccgtctccatggtccatgctggggacggcacccatcgcttctttgttgccgagcaggtaggagtggtgtgggtctacctccctgatgggagtcgcctggagcaacccttcctggacctcaagaacatcgtgttgaccaccccatggatcggggatgagagaggcttcttggggttggcttttcaccccaaattccgccacaatcgcaagttctatatttattattcgtgcctggacaagaagaaggtagaaaagatccgaattagtgagatgaaggtttctcgggctgatcctaacaaagctgacctgaaatcagagagggtcatcttggagattgaagaaccagcctcaaaccataatggcggacaacttctttttggcctggatggctatatgtacatattcactggggacgggggacaggctggagatccctttggcctgtttggaaatgctcagaacaaaagttccctgctgggaaaagttttaaggatcgatgtgaacagggcaggctcacatggcaagcggtaccgagtcccctcggacaatccatttgtttctgagccaggggcccaccccgccatctatgcctatgggatcaggaacatgtggcgttgtgctgtggaccgaggggaccccatcacgcgccagggccgaggccggatattctgtggggacgtgggccagaacaggtttgaatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - CD27 molecule - synaptoporin - CD82 molecule - CD38 molecule |