> >>KCNG4-potassium voltage-gated channel, subfamily G, member 4 Gene
KCNG4-potassium voltage-gated channel, subfamily G, member 4 Gene View larger

KCNG4-potassium voltage-gated channel, subfamily G, member 4 Gene

PTXBC008969

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of KCNG4-potassium voltage-gated channel, subfamily G, member 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KCNG4-potassium voltage-gated channel, subfamily G, member 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008969
Product type: DNA & cDNA
Ncbi symbol: KCNG4
Origin species: Human
Product name: KCNG4-potassium voltage-gated channel, subfamily G, member 4 Gene
Size: 2ug
Accessions: BC008969
Gene id: 93107
Gene description: potassium voltage-gated channel, subfamily G, member 4
Synonyms: KV6.3; KV6.4; potassium voltage-gated channel subfamily G member 4; potassium channel, voltage gated modifier subfamily G, member 4; potassium voltage-gated channel, subfamily G, member 4; voltage-gated potassium channel Kv6.3; voltage-gated potassium channel subunit Kv6.4; potassium voltage-gated channel modifier subfamily G member 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcccatgccttccagagacgggggcctgcatcccagacaccaccactatggttcccacagcccttggagtcagctcctgtccagccccatggagacgccgtccatcaagggcctttactaccggagggtgcggaaggtgggtgccctggacgcctccccagtggacctgaagaaggagatcctgatcaacgtggggggcaggaggtatctcctcccctggagcacactggaccggttcccgctgagccgcctgagcaaactcaggctctgtcggagctacgaggagatcgtgcagctctgcgatgattacgacgaggacagccaggagttcttcttcgacaggagccccagcgccttcggggtgatcgtgagcttcctggcggccgggaagctggtgcttctgcaggagatgtgcgcgctgtccttccaggaggagctggcctactggggcatcgaggaggcccacctggagaggtgctgcctgcggaagctgctgaggaagctggaggagctggaggagctggccaagctgcacagggaggacgtactgaggcagcagagggagacccgccgccccgcctcgcactcctcgcgctggggcctgtgcatgaaccggctgcgcgagatggtggaaaacccgcagtccgggctgcccgggaaggtcttcgcttgcctctccatcctcttcgtggccaccacagccgtcagcctgtgtgtcagcaccatgcccgacctcagggcagaggaggaccaggtgagcggcctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae)
- proteasome (prosome, macropain) subunit, alpha type, 1
- vacuolar protein sorting 37 homolog B (S. cerevisiae)
- cyclin-dependent kinase 5, regulatory subunit 1 (p35)

Reviews

Buy KCNG4-potassium voltage-gated channel, subfamily G, member 4 Gene now

Add to cart