PTXBC007218
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC007218 |
Product type: | DNA & cDNA |
Ncbi symbol: | FYCO1 |
Origin species: | Human |
Product name: | FYCO1-FYVE and coiled-coil domain containing 1 Gene |
Size: | 2ug |
Accessions: | BC007218 |
Gene id: | 79443 |
Gene description: | FYVE and coiled-coil domain containing 1 |
Synonyms: | CATC2; CTRCT18; RUFY3; ZFYVE7; FYVE and coiled-coil domain-containing protein 1; RUN and FYVE domain containing 3; zinc finger FYVE domain-containing protein 7; FYVE and coiled-coil domain containing 1 |
Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
Orf sequence: | atgaacaccaaagtgaccagtgactggtactatgcaagaagcccctttctgcagccaaagctgagctcggacattgtgggccaactctatgagctgactgaggttcagtttgacctggcgtcgaggggctttgacttggatgctgcctggccaacatttgccaggaggacgctgaccactggctcttctgcttacctgtggaaaccccctagccgcagctccagcatgagcagcttggtgagcagctacctgcagactcaagagatggtgtccaactttgacctgaacagccccctaaacaacgaggcattggagggctttgatgagatgcgactagagctggaccagttggaggtgcgggagaagcagctacaggagcgcatgcagcagctggacagagagaaccaggagctgagggcagctgtcagccagcaaggggagcaactgcagacagagagggagagggggcgcactgcagcggaggacaacgttcgcctcacttgcttggtagctgagctccagaagcagtgggaggtcacccaggccacccagaacactgtgaaggagctgcagacatgcctgcaggccctggagctaggagcagcagagaaggaggaggactaccacacagccctgcggcggctggagtccatgctgcagcccttggcacaggagcttgaggccacacgggactcactggacaagaaaaaccagcatttagccagcttcccaggctggctagccatggccctgcatgttggagactga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20℃ |
Delivery condition: | Blue Ice |
Related products: | - OTU domain, ubiquitin aldehyde binding 1 - OTU domain, ubiquitin aldehyde binding 1 - procollagen C-endopeptidase enhancer 2 - chromosome 14 open reading frame 104 |