Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PSME3-proteasome (prosome, macropain) activator subunit 3 (PA28 gamma, Ki) Gene
PTXBC001423
New product
Data sheet of PSME3-proteasome (prosome, macropain) activator subunit 3 (PA28 gamma, Ki) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PSME3-proteasome (prosome, macropain) activator subunit 3 (PA28 gamma, Ki) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001423 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PSME3 |
| Origin species: | Human |
| Product name: | PSME3-proteasome (prosome, macropain) activator subunit 3 (PA28 gamma, Ki) Gene |
| Size: | 2ug |
| Accessions: | BC001423 |
| Gene id: | 10197 |
| Gene description: | proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki) |
| Synonyms: | HEL-S-283; PA28-gamma; PA28G; PA28gamma; REG-GAMMA; proteasome activator complex subunit 3; 11S regulator complex gamma subunit; 11S regulator complex subunit gamma; Ki antigen; Ki nuclear autoantigen; PA28 gamma variant 5; REG gamma-3; activator of multicatalytic protease subunit 3; epididymis secretory protein Li 283; proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki); proteasome activator 28 subunit gamma; proteasome activator 28-gamma; proteasome activator subunit 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcctcgttgctgaaggtggatcaggaagtgaagctcaaggttgattctttcagggagcggatcacaagtgaggcagaagacttggtggcaaattttttcccaaagaagttattagaacttgatagttttctgaaggaaccaatcttaaacatccatgacctaactcagatccactctgacatgaatctcccagtccctgaccccattcttctcaccaatagccatgatggactggatggtcccacttataagaagcgaaggttggatgagtgtgaagaagccttccaaggaaccaaggtgtttgtgatgcccaatgggatgctgaaaagcaaccagcagctggtggacattattgagaaagtgaaacctgagatccggctgttgattgagaaatgtaacacggtcaaaatgtgggtacagctcctgattcccaggatagaagatggaaacaactttggggtgtccattcaggaggaaacagttgcagagctaagaactgttgagagtgaagctgcatcttatctggaccagatttctagatattatattacaagagccaaattggtttctaaaatagctaaatatccccatgtggaggactatcgccgcaccgtgacagagattgatgagaaagaatatatcagccttcggctcatcatatcagagctgaggaatcaatatgtcactctacatgacatgatcctgaaaaatatcgagaagatcaaacggccccggagcagcaatgcagagactctgtactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae) - nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) - small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha - gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase) |