PTXBC009930
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC009930 |
Product type: | DNA & cDNA |
Ncbi symbol: | FRAG1 |
Origin species: | Human |
Product name: | FRAG1-FGF receptor activating protein 1 Gene |
Size: | 2ug |
Accessions: | BC009930 |
Gene id: | 27315 |
Gene description: | FGF receptor activating protein 1 |
Synonyms: | FRAG1; CWH43-N; HPMRS3; MRT17; MRT21; post-GPI attachment to proteins factor 2; FGF receptor activating protein 1; cell wall biogenesis 43 N-terminal homolog; mental retardation, non-syndromic, autosomal recessive, 21; post-GPI attachment to proteins 2 |
Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
Orf sequence: | atgtaccaggtcccactaccactggatcgggatgggaccctggtacggctccgcttcaccatggtggccctggtcacggtctgctgtccacttgtcgccttcctcttctgcatcctctggtccctgctcttccacttcaaggagacaacggccacacactgtggggtgcccaattacctgccctcggtgagctcagccatcggcggggaggtgccccagcgctacgtgtggcgtttctgcatcggcctgcactcggcgcctcgcttcttggtggccttcgcctactggaaccactacctcagctgcacctccccgtgttcctgctatcgcccgctctgccgcctcaacttcggcctcaatgtcgtggagaacctcgcgttgctagtgctcacttatgtctcctcctccgaggacttcaccatccacgaaaatgctttcattgtgttcattgcctcatccctcgggcacatgctcctcacctgcattctctggcggttgaccaagaagcacacagatcgcaagtcctacagctggaaacagcggctcttcatcatcaacttcatctccttcttctcggcgctggctgtctactttcggcacaacatgtattgtgaggctggagtgtacaccatctttgccatcctggagtacactgttgtcttaaccaacatggcgttccacatgacggcctggtgggacttcgggaacaaggagctgctcataacctctcagcctgaggaaaagcgattctga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20℃ |
Delivery condition: | Blue Ice |
Related products: | - zinc finger, AN1-type domain 2B - ribosomal protein S4, Y-linked 1 - odd-skipped related 2 (Drosophila) - nuclear receptor binding factor 2 |