Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PLEKHF2-pleckstrin homology domain containing, family F (with FYVE domain) member 2 Gene
PTXBC011806
New product
Data sheet of PLEKHF2-pleckstrin homology domain containing, family F (with FYVE domain) member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PLEKHF2-pleckstrin homology domain containing, family F (with FYVE domain) member 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011806 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PLEKHF2 |
| Origin species: | Human |
| Product name: | PLEKHF2-pleckstrin homology domain containing, family F (with FYVE domain) member 2 Gene |
| Size: | 2ug |
| Accessions: | BC011806 |
| Gene id: | 79666 |
| Gene description: | pleckstrin homology domain containing, family F (with FYVE domain) member 2 |
| Synonyms: | EAPF; PHAFIN2; ZFYVE18; pleckstrin homology domain-containing family F member 2; PH and FYVE domain-containing protein 2; PH domain-containing family F member 2; endoplasmic reticulum-associated apoptosis-involved protein containing PH and FYVE domains; pleckstrin homology domain containing, family F (with FYVE domain) member 2; zinc finger FYVE domain-containing protein 18; pleckstrin homology and FYVE domain containing 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtggatcgcttggcaaacagtgaagcaaatactagacgtataagtatagtggaaaactgttttggagcagctggtcaacctttaactatacctggacgagttcttattggagaaggagtattgactaagttgtgcaggaaaaagcccaaagcaaggcagtttttcttgtttaatgatattcttgtatatggcaatattgtcatccagaagaaaaaatataacaaacaacatattattcccctggaaaatgtcactattgattccatcaaagatgagggagacttaaggaatggatggctaatcaagacaccaactaaatcttttgcagtttatgctgccactgctacggagaaatcagaatggatgaatcatataaataaatgtgttactgatttactctccaaaagtgggaagacacccagtaatgaacatgctgctgtctgggttcctgactctgaggcaactgtatgtatgcgttgtcagaaagcaaaattcacacctgttaatcgtcgccaccattgccgcaaatgtggttttgttgtctgtgggccctgctctgaaaagagatttcttcttcccagccagtcctctaagcctgtgcggatttgtgacttctgctatgacctgctttctgctggggacatggccacatgccagcctgctagatcagactcttacagccagtcattgaagtctcctttaaatgatatgtctgatgatgatgacgatgatgatagcagtgactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - pleckstrin homology domain containing, family F (with FYVE domain) member 1 - ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 - protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 - hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 |