Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
UTP23-UTP23, small subunit (SSU) processome component, homolog (yeast) Gene
PTXBC005955
New product
Data sheet of UTP23-UTP23, small subunit (SSU) processome component, homolog (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UTP23-UTP23, small subunit (SSU) processome component, homolog (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005955 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UTP23 |
| Origin species: | Human |
| Product name: | UTP23-UTP23, small subunit (SSU) processome component, homolog (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC005955 |
| Gene id: | 84294 |
| Gene description: | UTP23, small subunit (SSU) processome component, homolog (yeast) |
| Synonyms: | UTP23, small subunit processome component; UTP23, small subunit (SSU) processome component, homolog; rRNA-processing protein UTP23 homolog; C8orf53 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagatcacaaggcagaaacatgccaagaagcatcttggcttcttccgcaacaacttcggagtccgcgagccgtaccagatcctgctggacggcaccttctgtcaggcggcgctgcggggccgcatccagctgcgggagcagctgccccgctacctcatgggggagacgcagctgtgcaccacaagatgtgtgttaaaagagctagaaacattgggaaaggacttatatggggcaaaactgattgcacaaaaatgccaagttcgaaattgtcctcatttcaagaatgcagtgagtggatcagaatgtctgctttccatggttgaagagggaaatcctcatcattattttgtggcaacacaggatcagaatttgtctgtgaaagtaaaaaagaagcctggagttcctctcatgtttattattcagaacactatggttttggacaaaccttctcccaaaacaattgcctttgtaaaagcagtggagtcaggtcagcttgtctcagtgcatgagaaagaaagtatcaaacatctcaaagaggaacagggtttagtgaaaaacactgaacagagtagaagaaaaaagcgcaagaaaataagtggtcccaatcctcttagttgtttgaagaaaaagaaaaaggcaccggacacacaatcatctgcttctgaaaagagaagaaaaagaaaaagaattcggaacagatctaacccaaaagtactttctgagaagcagaatgcagaaggagaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) - NSL1, MIND kinetochore complex component, homolog (S. cerevisiae) - dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) - cytosolic iron-sulfur protein assembly 1 homolog (S. cerevisiae) |