Cart 7 Product Products 822,27 € (empty)
-
1 x SUCLG2-suc...121,50 € -
1 x CUEDC2-CUE...113,40 € -
1 x AVL9-AVL9...121,50 € -
1 x CCDC51-coi...121,50 € -
-
1 x CDCA3-cell...121,50 € -
1 x FAM168A-fa...113,40 €
No products
To be determined Shipping
822,27 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 7 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 822,27 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 822,27 €
Data sheet of SLC45A2-solute carrier family 45, member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC45A2-solute carrier family 45, member 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003597 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC45A2 |
| Origin species: | Human |
| Product name: | SLC45A2-solute carrier family 45, member 2 Gene |
| Size: | 2ug |
| Accessions: | BC003597 |
| Gene id: | 51151 |
| Gene description: | solute carrier family 45, member 2 |
| Synonyms: | 1A1; AIM1; MATP; OCA4; SHEP5; membrane-associated transporter protein; melanoma antigen AIM1; protein AIM-1; underwhite; solute carrier family 45 member 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggtagcaacagtgggcaggctggccgccacatctataaatccctagctgatgatggcccctttgactctgtggagccgcctaaaagacccaccagcagactcatcatgcacagcatggccatgttcggaagagagttctgctacgcggtggaggcagcgtatgtgaccccagtcctgctcagcgtaggtctgcccagcagcctgtacagcattgtgtggttcctcagccccatcctgggattcctgctgcagcccgtggtcggatcggccagcgaccactgccggtccaggtggggccgccggagaccctacatcctcaccctgggagtcatgatgctcgtgggcatggctctgtacctcaatggggctactgttgtagcagctttgattgctaacccaaggaggaagctggtttgggccataagtgtcaccatgataggtgtcgttctctttgattttgctgccgacttcattgatgggcccatcaaagcctacttatttgatgtctgctcccatcaggacaaggagaagggcctccactaccatgccctcttcacagactcgcagggcaatgacattaaagtcactgctgagagcactggtgaacatgcctcctcactaccgctacctttgcatcagccacctcattggatggacggccttcctgtccaacatgctgttcttcacagatttcatgggccagattgtgtaccgcggggatccctatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 7 open reading frame 45 - mitochondrial ribosomal protein L45 - GLI pathogenesis-related 1 like 2 - 5'-nucleotidase, cytosolic III-like |