Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ANKS6-ankyrin repeat and sterile alpha motif domain containing 6 Gene
PTXBC012981
New product
Data sheet of ANKS6-ankyrin repeat and sterile alpha motif domain containing 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ANKS6-ankyrin repeat and sterile alpha motif domain containing 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012981 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ANKS6 |
| Origin species: | Human |
| Product name: | ANKS6-ankyrin repeat and sterile alpha motif domain containing 6 Gene |
| Size: | 2ug |
| Accessions: | BC012981 |
| Gene id: | 203286 |
| Gene description: | ankyrin repeat and sterile alpha motif domain containing 6 |
| Synonyms: | ANKRD14; NPHP16; PKDR1; SAMD6; ankyrin repeat and SAM domain-containing protein 6; SAM domain-containing protein 6; ankyrin repeat domain 14; samCystin; ankyrin repeat and sterile alpha motif domain containing 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccaattagggatgacataagctggcccccgagtgctgtgtgttcagtgtcactaattctccatcttcctggcagatttgggcatgtgagtgtggcacacctcctgttggatcacggggctgatgtcaatgcccagaaccggctgggggccagtgtgctcactgtggcttctcggggcggccacctgggtgtggtgaagctgctcctggaagccggtgcctttgtggaccatcaccacccttcaggcgagcaactggggttgggcggcagcagggatgagcccttggacatcacagccctgatggctgccatccagcacgggcacgaggccgtggtgcgtctactgatggagtggggcgcggaccccaaccacgcagcccggaccgtgggctggagcccgctgatgctggccgcactcactgggcggcttggagtggcccagcagctggtggagaagggcgccaaccctgaccacctcagcgtgctggagaagaccgccttcgaggttgcactggactgcaagcacagggaccttgtagactacctggacccgctgaccaccgtcaggcccaaaacaggtcaggctgcatgccccccgtggcttcacagaggaccccaaattgtgtttatgtggcttaagctgaggattgctctactggaaggacacgcagaactcagagtccagccctgcagaccactgagactgaggaagtggtgtgcttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast) - DIM1 dimethyladenosine transferase 1-like (S. cerevisiae) - N-ethylmaleimide-sensitive factor attachment protein, alpha - N-acetylglucosamine-1-phosphate transferase, gamma subunit |