Cart 13 Product Products 1 672,37 € (empty)
-
1 x UBR7-ubiqu...121,50 € -
1 x RABEPK-Rab...121,50 € -
1 x TRIM29-tri...121,50 € -
-
1 x MMP7-matri...121,50 € -
1 x DHCR7-7-de...121,50 € -
1 x LY6K-lymph...113,40 € -
1 x FAM96A-fam...113,40 € -
-
1 x LOC441493-...113,40 € -
1 x CDC42SE1-C...113,40 € -
1 x Olfactory...259,07 € -
1 x ARL6IP5-AD...113,40 €
No products
To be determined Shipping
1 672,37 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 13 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 672,37 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 672,37 €
Data sheet of DLX4-distal-less homeobox 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DLX4-distal-less homeobox 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016145 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DLX4 |
| Origin species: | Human |
| Product name: | DLX4-distal-less homeobox 4 Gene |
| Size: | 2ug |
| Accessions: | BC016145 |
| Gene id: | 1748 |
| Gene description: | distal-less homeobox 4 |
| Synonyms: | BP1; DLX7; DLX8; DLX9; OFC15; homeobox protein DLX-4; beta protein 1; distal-less homeo box 7; distal-less homeo box 9; homeobox protein DLX-7; homeobox protein DLX-8; distal-less homeobox 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacctctttgccctgccccctccccggccgggacgcctccaaagctgtcttcccagacctcgcccctgtcccgtcggtagcggctgcctacccgcttggcttgtcccctacaaccgcagcctcccccaatttgtcctactccaggccgtatggccacctcctgtcttacccctacaccgagccagcgaaccccggagactcctacctgtcctgccagcaacccgcggcgctctctcagcccctctgcggacctgcagagcaccctcaggaactcgaggcagactcggagaagccgcggctgtccccggaaccctccgagcggcgccctcaggcccccgccaaaaagctccgcaagccgaggaccatctactccagcctgcagctgcagcacctaaaccagcgtttccagcacacgcagtacctggcgctgcccgagagggcccagctggcagcgcagctcggcctcacccagacccaggtaaagatctggtttcagaacaaacgctccaagtataagaagctcctgaagcagaattctggggggcaggaaggggacttccctgggaggaccttctctgtgtctccctgctccccacccctcccctccctctgggatctacccaaggcagggaccctgcccaccagtggctatggcaacagctttggagcctggtatcagcatcactcctcagatgtcctggcttcgcctcagatgatgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ribosomal protein S3A - RASD family, member 2 - WD repeat domain 42A - Lix1 homolog (chicken) |