Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PSME2-proteasome (prosome, macropain) activator subunit 2 (PA28 beta) Gene
PTXBC004368
New product
Data sheet of PSME2-proteasome (prosome, macropain) activator subunit 2 (PA28 beta) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PSME2-proteasome (prosome, macropain) activator subunit 2 (PA28 beta) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004368 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PSME2 |
| Origin species: | Human |
| Product name: | PSME2-proteasome (prosome, macropain) activator subunit 2 (PA28 beta) Gene |
| Size: | 2ug |
| Accessions: | BC004368 |
| Gene id: | 5721 |
| Gene description: | proteasome (prosome, macropain) activator subunit 2 (PA28 beta) |
| Synonyms: | PA28B; PA28beta; REGbeta; proteasome activator complex subunit 2; 11S regulator complex beta subunit; 11S regulator complex subunit beta; MCP activator, 31-kD subunit; REG-beta; activator of multicatalytic protease subunit 2; cell migration-inducing protein 22; proteasome (prosome, macropain) activator subunit 2 (PA28 beta); proteasome activator 28 subunit beta; proteasome activator 28-beta; proteasome activator hPA28 subunit beta; proteasome activator subunit 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccaagccgtgtggggtgcgcctgagcggggaagcccgcaaacaggtggaggtcttcagacagaatcttttccaggaggctgaggaattcctctacagattcttgccacagaaaatcatatacctgaatcagctcttgcaagaggactccctcaatgtggctgacttgacttccctccgggccccactggacatccccatcccagaccctccacccaaggatgatgagatggaaacagataagcaggagaagaaagaagtccctaagtgtggatttctccctgggaatgagaaagtcctgtccctgcttgccctggttaagccagaagtctggactctcaaagagaaatgcattctggtgattacatggatccaacacctgatccccaagattgaagatggaaatgattttggggtagcaatccaggagaaggtgctggagagggtgaatgccgtcaagaccaaagtggaagctttccagacaaccatttccaagtacttctcagaacgtggggatgctgtggccaaggcctccaaggagactcatgtaatggattaccgggccttggtgcatgagcgagatgaggcagcctatggggagctcagggccatggtgctggacctgagggccttctatgctgagctttatcatatcatcagcagcaacctggagaaaattgtcaacccaaagggtgaagaaaagccatctatgtactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - MIT, microtubule interacting and transport, domain containing 1 - endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 - tumor necrosis factor receptor superfamily, member 6b, decoy - vesicle amine transport protein 1 homolog (T. californica)-like |