Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of DNAJA4-DnaJ (Hsp40) homolog, subfamily A, member 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DNAJA4-DnaJ (Hsp40) homolog, subfamily A, member 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC031044 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DNAJA4 |
| Origin species: | Human |
| Product name: | DNAJA4-DnaJ (Hsp40) homolog, subfamily A, member 4 Gene |
| Size: | 2ug |
| Accessions: | BC031044 |
| Gene id: | 55466 |
| Gene description: | DnaJ (Hsp40) homolog, subfamily A, member 4 |
| Synonyms: | MST104; MSTP104; PRO1472; dnaJ homolog subfamily A member 4; DnaJ (Hsp40) homolog, subfamily A, member 4; DnaJ heat shock protein family (Hsp40) member A4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcagatccacatccagcagatcgggccgggcatggtacagcagatccagaccgtgtgcatcgagtgcaagggccagggtgagcgcatcaaccccaaggaccgctgcgagagctgcagcggggccaaggtgatccgtgagaagaagattatcgaggtacatgttgaaaaaggtatgaaagatgggcaaaagatactatttcgtggagaaggagatcaggagcctgagctggagcctggtgatgtcataattgtgcttgatcagaaggatcatagtgtctttcagagacgaggccatgacttgatcatgaaaatgaaaattcagctttctgaagctctttgtggcttcaagaagacgataaaaacattggacaatcgaattcttgttattacatccaaagcaggtgaggtgataaagcacggggacctgagatgcgtgcgcgatgaaggaatgcccatctacaaagcacccctggaaaaagggattctgatcatacagtttttagtaatctttcctgaaaaacactggctttctctggaaaagcttcctcagctggaagctttactccctcctcgacagaaagtgaggattacagatgacatggatcaggtggagctgaaggagttttgtcccaatgagcagaactggcgtcagcacagggaggcctacgaggaggacgaagacgggccccaggctggagtgcagtgccagacggcatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - receptor (chemosensory) transporter protein 4 - complement component 4 binding protein, beta - palate, lung and nasal epithelium associated - phosphatidylinositol transfer protein, beta |