Cart 6 Product Products 686,95 € (empty)
-
1 x HSPB2-heat...113,40 € -
1 x KMO-kynure...121,50 € -
-
1 x PCGF6-poly...121,50 € -
-
1 x SELV-selen...121,50 €
No products
To be determined Shipping
686,95 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 6 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 686,95 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 686,95 €
Data sheet of RNF32-ring finger protein 32 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RNF32-ring finger protein 32 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015416 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RNF32 |
| Origin species: | Human |
| Product name: | RNF32-ring finger protein 32 Gene |
| Size: | 2ug |
| Accessions: | BC015416 |
| Gene id: | 140545 |
| Gene description: | ring finger protein 32 |
| Synonyms: | FKSG33; HSD15; LMBR2; RING finger protein 32 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttaaaaaataagggtcactcatctaagaaagataacttggcagtcaatgcagttgctttacaagatcacattttacatgatcttcaacttcgaaatctttcagttgcagatcattctaagacacaagtacaaaagaaagagaacaaatctctaaaaagagatacaaaggcaataatagatactggacttaaaaaaactacacagtgccccaaactagaagactcagaaaaagaatatgttcttgatcccaaaccgccgccgttgactttggcacagaagttgggcctcattgggcctccaccacctccactgtcatcagatgaatgggagaaggtgaaacagcgctctctcctgcaaggggactccgtgcaaccatgccccatctgtaaagaagaattcgagcttcgtcctcaggtgctgctttcatgctcccatgtgttccacaaagcatgtcttcaggcttttgaaaagttcacaaataagaaaacctgtcctctctgtagaaagaaccagtatcaaacccgagtgatacacgatggggcccgcctgttcagaatcaagtgtgtgaccagaatccaagcctactggagaggatgtgttgttagaaagtggtacagaaacctgaggaaaacagtacctcccacagatgccaagttaagaaaaaaattctttgaaaaaaagacacaagactggaaaccagcttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - zinc finger protein 99 - ring finger protein 32 - X-box binding protein 1 - kinesin family member 6 |