Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 84,65 €
Total shipping (tax excl.) 185,00 €
Total (tax excl.) 269,65 €
View larger 
HERPUD1-homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 Gene
PTXBC009739
New product
Data sheet of HERPUD1-homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HERPUD1-homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009739 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HERPUD1 |
| Origin species: | Human |
| Product name: | HERPUD1-homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 Gene |
| Size: | 2ug |
| Accessions: | BC009739 |
| Gene id: | 9709 |
| Gene description: | homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 |
| Synonyms: | HERP; Mif1; SUP; homocysteine-responsive endoplasmic reticulum-resident ubiquitin-like domain member 1 protein; MMS-inducible; homocysteine-inducible endoplasmic reticulum stress-inducible ubiquitin-like domain member 1 protein; homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1; methyl methanesulfonate (MMF)-inducible fragment protein 1; homocysteine inducible ER protein with ubiquitin like domain 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagtccgagaccgaacccgagcccgtcacgctcctggtgaagagccccaaccagcgccaccgcgacttggagctgagtggcgaccgcggctggagtgtgggccacctcaaggcccacctgagccgcgtctaccccgagcgtccgcgtccagaggaccagaggttaatttattctgggaagctgttgttggatcaccaatgtctcagggacttgcttccaaaggaaaaacggcatgttttgcatctggtgtgcaatgtgaagagtccttcaaaaatgccagaaatcaacgccaaggtggctgaatccacagaggagcctgctggttctaatcggggacagtatcctgaggattcctcaagtgatggtttaaggcaaagggaagttcttcggaacctttcttcccctggatgggaaaacatctcaaggcatcacgttgggtggtttccatttagaccgaggccggttcagaacttcccaaatgatggtcctcctcctgacgttgtaaatcaggaccccaacaataacttacaggaaggcactgatcctgaaactgaagaccccaaccacctccctccagacagggatgtactagatggcgagcagaccagcccctcctttatgagcacagcatggcttgtcttcaagactttctttgcctctcttcttccagaaggccccccagccatcgcaaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 - solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1) - platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog) - BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae) |