Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
HLA-DQB2-major histocompatibility complex, class II, DQ beta 2 Gene
PTXBC031995
New product
Data sheet of HLA-DQB2-major histocompatibility complex, class II, DQ beta 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HLA-DQB2-major histocompatibility complex, class II, DQ beta 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC031995 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HLA-DQB2 |
| Origin species: | Human |
| Product name: | HLA-DQB2-major histocompatibility complex, class II, DQ beta 2 Gene |
| Size: | 2ug |
| Accessions: | BC031995 |
| Gene id: | 3120 |
| Gene description: | major histocompatibility complex, class II, DQ beta 2 |
| Synonyms: | HLA-DQB1; HLA-DXB; HLA class II histocompatibility antigen, DQ beta 2 chain; DV19.1 (major histocompatibility complex, class II, DQ beta 2 (HLA-DXB)); HLA class II histocompatibility antigen, DX beta chain; MHC class II antigen DQB2; major histocompatibility complex, class II, DQ beta 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcttggaagatggctctgcagatccctggaggcttttgggcagcagctgtgaccgtgatgctggtgatgctgagcaccccagtggctgaggccagagactttcccaaggatttcttggtccagtttaagggcatgtgctacttcaccaacgggacagagcgcgtgcggggtgtggccagatacatctataaccgcgaggagtacgggcgcttcgacagcgacgttggggagttccaggcggtgaccgagctggggcggagcatcgaggactggaacaactataaggacttcttggagcaggagcgggccgcggtggacaaggtgtgcagacacaactacgaggcggagctacgcacgaccttgcagcggcaagtggagcccacagtgaccatctccccatccaggacagaggccctcaaccaccacaacctgctggtctgctcagtgacagatttctatccagcccagatcaaagtccagtggtttcggaatgaccaggaggagacagccggtgttgtgtccacctccctcattaggaatggtgactggaccttccagattctggtgatgctggaaataactccccagcgtggagacatctacacctgccaagtggagcaccccagcctccagagccccatcaccgtggagtggcgacctcgagggcctccacctgcaggactcctgcactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - haloacid dehalogenase-like hydrolase domain containing 3 - cytidine monophosphate N-acetylneuraminic acid synthetase - splA/ryanodine receptor domain and SOCS box containing 2 - major histocompatibility complex, class II, DR beta 1 |