Cart 8 Product Products 917,49 € (empty)
-
1 x ISG20L2-in...121,50 € -
-
-
1 x NPTN-neuro...121,50 € -
1 x LIPA-lipas...121,50 € -
-
1 x PSMB10-pro...121,50 € -
No products
To be determined Shipping
917,49 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 8 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 917,49 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 917,49 €
View larger 
LRAT-lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase) Gene
PTXBC031053
New product
Data sheet of LRAT-lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LRAT-lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC031053 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LRAT |
| Origin species: | Human |
| Product name: | LRAT-lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase) Gene |
| Size: | 2ug |
| Accessions: | BC031053 |
| Gene id: | 9227 |
| Gene description: | lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase) |
| Synonyms: | LCA14; lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagaaccccatgctggaggtggtgtctttactactggagaagctgctcctcatctccaacttcacgctctttagttcgggcgccgcgggcgaagacaaagggaggaacagtttttatgaaaccagctctttccaccgaggcgacgtgctggaggtgccccggacccacctgacccactatggcatctacctaggagacaaccgtgttgcccacatgatgcccgacatcctgttggccctgacagacgacatggggcgcacgcagaaggtggtctccaacaagcgtctcatcctgggcgttattgtcaaagtggccagcatccgcgtggacacagtggaggacttcgcctacggagctaacatcctggtcaatcacctggacgagtccctccagaaaaaggcactgctcaacgaggaggtggcgcggagggctgaaaagctgctgggctttaccccctacagcctgctgtggaacaactgcgagcacttcgtgacctactgcagatatggcaccccgatcagtccccagtccgacaagttttgtgagactgtgaagataattattcgtgatcagagaagtgttcttgcttcagcagtcttgggattggcgtctatagtctgtacgggcttggtatcatacactacccttcctgcaatttttattccattcttcctatggatggctggctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa - small inducible cytokine subfamily E, member 1 (endothelial monocyte-activating) - solute carrier family 7, (neutral amino acid transporter, y+ system) member 10 - myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse) |