Cart 5 Product Products 1 009,87 € (empty)
-
1 x C-Reactive...544,00 € -
1 x M6PR-manno...121,50 € -
-
1 x SPANXE-SPA...113,40 € -
1 x ARC-activi...121,50 €
No products
To be determined Shipping
1 009,87 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 5 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 009,87 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 009,87 €
Data sheet of AK3-adenylate kinase 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AK3-adenylate kinase 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013771 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AK3 |
| Origin species: | Human |
| Product name: | AK3-adenylate kinase 3 Gene |
| Size: | 2ug |
| Accessions: | BC013771 |
| Gene id: | 50808 |
| Gene description: | adenylate kinase 3 |
| Synonyms: | GTP:AMP phosphotransferase AK3, mitochondrial; AK3L1; AK6; AKL3L; AKL3L1; FIX; GTP:AMP phosphotransferase, mitochondrial; adenylate kinase 3 alpha-like 1; adenylate kinase 6, adenylate kinase 3 like 1; adenylate kinase 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggggcgtccgcgcggctgctgcgagcggtgatcatgggggccccgggctcgggcaagggcaccgtgtcgtcgcgcatcactacacacttcgagctgaagcacctctccagcggggacctgctccgggacaacatgctgcggggcacagaaattggcgtgttagccaaggctttcattgaccaagggaaactcatcccagatgatgtcatgactcggctggcccttcatgagctgaaaaatctcacccagtatagctggctgttggatggttttccaaggacacttccacaggcagaagccctagatagagcttatcagatcgacacagtgattaacctgaatgtgccctttgaggtcattaaacaacgccttactgctcgctggattcatcccgccagtggccgagtctataacattgaattcaaccctcccaaaactgtgggcattgatgacctgactggggagcctctcattcagcgtgaggatgataaaccagagacggttatcaagagactaaaggcttatgaagaccaaacaaagccagtcctggaatattaccagaaaaaaggggtgctggaaacattctccggaacagaaaccaacaagatttggccctatgtatatgctttcctacaaactaaagttccacaaagaagccagaaagcttcagttactccatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ropporin 1-like - MAX-like protein X - tetraspanin 14 - tetraspanin 18 |