Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of IQCH-IQ motif containing H Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IQCH-IQ motif containing H Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC031041 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IQCH |
| Origin species: | Human |
| Product name: | IQCH-IQ motif containing H Gene |
| Size: | 2ug |
| Accessions: | BC031041 |
| Gene id: | 64799 |
| Gene description: | IQ motif containing H |
| Synonyms: | NYDSP5; IQ domain-containing protein H; testis development protein NYD-SP5; IQ motif containing H |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaagtcaaaacacctttgagagccctgaaatcactgtgggattatgactttttaatttatgatggtgtcatagacaatacagccccagacttcttagcattcaaggaacattttagcttagcttggggaggtattttttctctcttggaacacgtcgagaagtttctcaggaactatgctataccagaagtcaaaataaaagggaataatttggtggccctccttccagagtttgagctgacgaataaacttaccagatatgaccttctctcagtgttagaggacccagctcatgtccaaatgctgataaatcttccagggcaaaggtacaagggccaagatggaaattcggaggccgccatgaagatccaagccacatggaaatgctacaaagcaagaaaattcttcctcttttatcgccagcagaagtgggcatcaggtgtgattgccattgcttggctgttatattgccataagactcgactaaagaagatactaaaggaatcacgtcagagacacctggagaattttcgcattcgagccaagcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggtataacacttttgcctgcaaatctatcagcaacctctattacccaccacattatggctccttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - exosome component 4 - Kruppel-like factor 6 - lysyl oxidase-like 4 - centromere protein K |