PTXBC025383
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC025383 |
Product type: | DNA & cDNA |
Ncbi symbol: | SOHLH2 |
Origin species: | Human |
Product name: | SOHLH2-spermatogenesis and oogenesis specific basic helix-loop-helix 2 Gene |
Size: | 2ug |
Accessions: | BC025383 |
Gene id: | 54937 |
Gene description: | spermatogenesis and oogenesis specific basic helix-loop-helix 2 |
Synonyms: | SOSF2; SPATA28; TEB1; bHLHe81; spermatogenesis- and oogenesis-specific basic helix-loop-helix-containing protein 2; spermatogenesis associated 28; testicular secretory protein Li 50; testicular secretory protein Li 51; spermatogenesis and oogenesis specific basic helix-loop-helix 2 |
Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
Orf sequence: | atggcttcctcaattatctgccaggagcactgccagatctcgggccaggcaaaaatagacatcttattagttggagatgtcactgtgggctacctggctgatactgtacagaaactatttgcaaacatagcagaagtcaccatcaccatcagtgacacgaaggaggcagcagcgcttttggatgattgcatattcaacatggttctcttgaaggtgccttcttcactaagtgccgaggagctggaagccatcaagttaattagatttggcaaaaagaaaaatacacattcactgtttgtttttataatccctgaaaattttaaaggttgtatttcagggcatggaatggatattgctttaactgaaccactgacaatggaaaaaatgagtaatgtggtaaaatactggacaacatgtccctcaaacactgttaagactgaaaacgcaactgggcctgaagaacttggattgcccctgcagaggtcctacagcgaacacctgggatattttcctactgatctatttgcctgctctgaatctttaaggaatggcaatgggcttgaattaaatgcttcgttgtcagagttcgagaaaaacaaaaagatctctcttcttcattcaagcaaggaaaaactaagaaggctgtacaggaagcatagcagcttctgtttctggtga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20℃ |
Delivery condition: | Blue Ice |
Related products: | - UTP23, small subunit (SSU) processome component, homolog (yeast) - proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) - NSL1, MIND kinetochore complex component, homolog (S. cerevisiae) - dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) |