Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PPAPDC1B-phosphatidic acid phosphatase type 2 domain containing 1B Gene
PTXBC033025
New product
Data sheet of PPAPDC1B-phosphatidic acid phosphatase type 2 domain containing 1B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPAPDC1B-phosphatidic acid phosphatase type 2 domain containing 1B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC033025 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPAPDC1B |
| Origin species: | Human |
| Product name: | PPAPDC1B-phosphatidic acid phosphatase type 2 domain containing 1B Gene |
| Size: | 2ug |
| Accessions: | BC033025 |
| Gene id: | 84513 |
| Gene description: | phosphatidic acid phosphatase type 2 domain containing 1B |
| Synonyms: | phosphatidate phosphatase PPAPDC1B; PPAPDC1B; DPPL1; phospholipid phosphatase 5; diacylglycerol pyrophosphate like 1; diacylglycerol pyrophosphate phosphatase-like 1; phosphatidic acid phosphatase type 2 domain containing 1B; phosphatidic acid phosphatase type 2 domain-containing protein 1B; testicular secretory protein Li 38 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtggctctaccggaacccctacgtggaggcggagtatttccccaccaagccgatgtttgttattgcatttctctctccactgtctctgatcttcctggccaaatttctcaagaaggcagacacaagagacagcagacaagcctgcctggctgccagccttgccctggctctgaatggcgtctttaccaacacaataaaactgatcgtagggaggccacgcccagatttcttctaccgctgcttccctgatgggctagcccattctgacttgatgtgtacaggggataaggacgtggtgaatgagggccgaaagagcttccccagtggacattcttcctttgcatttgctggtctggcctttgcgtccttctacctggcagggaagttacactgcttcacaccacaaggccgtgggaaatcttggaggttctgtgcctttctgtcacctctactttttgcagctgtgattgcactgtcccgcacatgtgactacaagcatcactggcaagatgtactagttggatccatgattggaatgacatttgcctatgtctgctatcggcagtattatcctcctctgactgatgcagaatgccataaaccatttcaagacaaacttgtactttccactgcacagaagcctggggattcttattgttttgatatttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - eukaryotic translation initiation factor 4E family member 2 - SEC22 vesicle trafficking protein homolog C (S. cerevisiae) - ubiquitin protein ligase E3 component n-recognin 7 (putative) - SEC22 vesicle trafficking protein homolog A (S. cerevisiae) |