GSTA2-glutathione S-transferase alpha 2 Gene View larger

GSTA2-glutathione S-transferase alpha 2 Gene

PTXBC002895

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GSTA2-glutathione S-transferase alpha 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GSTA2-glutathione S-transferase alpha 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002895
Product type: DNA & cDNA
Ncbi symbol: GSTA2
Origin species: Human
Product name: GSTA2-glutathione S-transferase alpha 2 Gene
Size: 2ug
Accessions: BC002895
Gene id: 2939
Gene description: glutathione S-transferase alpha 2
Synonyms: GSTA2-2; GST2; GTA2; GTH2; glutathione S-transferase A2; GST HA subunit 2; GST class-alpha member 2; GST-gamma; S-(hydroxyalkyl)glutathione lyase A2; glutathione S-alkyltransferase A2; glutathione S-aralkyltransferase A2; glutathione S-aryltransferase A2; liver GST2; testis tissue sperm-binding protein Li 59n; glutathione S-transferase alpha 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagagaagcccaagctccactactccaatatacggggcagaatggagtccatccggtggctcctggctgcagctggagtagagtttgaagagaaatttataaaatctgcagaagatttggacaagttaagaaatgatggatatttgatgttccagcaagtgccaatggttgagattgatgggatgaagctggtgcagaccagagccattctcaactacattgccagcaaatacaacctctatgggaaagacataaaggagaaagccctgattgatatgtatatagaaggtatagcagatttgggtgaaatgatccttcttctgccctttactcaacctgaggaacaagatgccaagcttgccttgatccaagagaaaacaaaaaatcgctacttccctgcctttgaaaaagtcttaaagagccacggacaagactaccttgttggcaacaagctgagccgggctgacattcacctggtggaacttctctactacgtggaagagcttgactctagccttatttccagcttccctctgctgaaggccctgaaaaccagaatcagtaacctgcccacagtgaagaagtttctacagcctggcagcccaaggaagcctcccatggatgagaaatctttagaagaatcaaggaagattttcaggttttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Kruppel-like factor 7 (ubiquitous)
- RAB23, member RAS oncogene family
- coiled-coil domain containing 42
- FGF receptor activating protein 1

Reviews

Buy GSTA2-glutathione S-transferase alpha 2 Gene now

Add to cart