Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TMED10-transmembrane emp24-like trafficking protein 10 (yeast) Gene
PTXBC001496
New product
Data sheet of TMED10-transmembrane emp24-like trafficking protein 10 (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMED10-transmembrane emp24-like trafficking protein 10 (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001496 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMED10 |
| Origin species: | Human |
| Product name: | TMED10-transmembrane emp24-like trafficking protein 10 (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC001496 |
| Gene id: | 10972 |
| Gene description: | transmembrane emp24-like trafficking protein 10 (yeast) |
| Synonyms: | P24(DELTA); S31I125; S31III125; TMP21; Tmp-21-I; p23; p24d1; transmembrane emp24 domain-containing protein 10; 21 kDa transmembrane trafficking protein; p24 family protein delta-1; p24delta; p24delta1; testicular tissue protein Li 206; transmembrane emp24-like trafficking protein 10; transmembrane protein Tmp21; transmembrane p24 trafficking protein 10 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctggtttgtctggcccaccagcccggcgcggcccttttccgttagcgttgctgcttttgttcctgctcggccccagattggtccttgccatctccttccatctgcccattaactctcgcaagtgcctccgtgaggagattcacaaggacctgctagtgactggcgcgtacgagatctccgaccagtctgggggcgctggcggcctgcgcagccacctcaagatcacagattctgctggccatattctctactccaaagaggatgcaaccaaggggaaatttgcctttaccactgaagattatgacatgtttgaagtgtgttttgagagcaagggaacagggcggatacctgaccaactcgtgatcctagacatgaagcatggagtggaggcgaaaaattacgaagagattgcaaaagttgagaagctcaaaccattagaggtagagctgcgacgcctagaagacctttcagaatctattgttaatgattttgcctacatgaagaagagagaagaggagatgcgtgataccaacgagtcaacaaacactcgggtcctatacttcagcatcttttcaatgttctgtctcattggactagctacctggcaggtcttctacctgcgacgcttcttcaaggccaagaaattgattgagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - coiled-coil-helix-coiled-coil-helix domain containing 3 - major histocompatibility complex, class II, DQ beta 2 - haloacid dehalogenase-like hydrolase domain containing 3 - cytidine monophosphate N-acetylneuraminic acid synthetase |