Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of EIF4E-eukaryotic translation initiation factor 4E Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about EIF4E-eukaryotic translation initiation factor 4E Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012611 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EIF4E |
| Origin species: | Human |
| Product name: | EIF4E-eukaryotic translation initiation factor 4E Gene |
| Size: | 2ug |
| Accessions: | BC012611 |
| Gene id: | 1977 |
| Gene description: | eukaryotic translation initiation factor 4E |
| Synonyms: | AUTS19; CBP; EIF4E1; EIF4EL1; EIF4F; eIF-4E; eukaryotic translation initiation factor 4E; eIF-4F 25 kDa subunit; eukaryotic translation initiation factor 4E-like 1; mRNA cap-binding protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgactgtcgaaccggaaaccacccctactcctaatcccccgactacagaagaggagaaaacggaatctaatcaggaggttgctaacccagaacactatattaaacatcccctacagaacagatgggcactctggttttttaaaaatgataaaagcaaaacttggcaagcaaacctgcggctgatctccaagtttgatactgttgaagacttttgggctctgtacaaccatatccagctgtctagtaatttaatgcctggctgtgactactcactttttaaggatggtattgagcctatgtgggaagatgagaaaaacaaacggggaggacgatggctaattacattgaacaaacagcagagacgaagtgacctcaatcgcttttggctagagacacttctgtgccttattggagaatcttttgatgactacagtgatgatgtatgtggcgctgttgttaatgttagagctaaaggtgataagatagcaatatggactactgaatgtgaaaacagagaagctgttacacatatagggagggtatacaaggaaaggttaggacttcctccaaagatagtgattggttatcagtcccacgcagacacagctactaagagcggctccaccactaaaaataggtttgttgtttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - eukaryotic translation initiation factor 4H - RNA-binding region (RNP1, RRM) containing 3 - serine-arginine repressor protein (35 kDa) - membrane-associated ring finger (C3HC4) 5 |