GRPEL1-GrpE-like 1, mitochondrial (E. coli) Gene View larger

GRPEL1-GrpE-like 1, mitochondrial (E. coli) Gene

PTXBC024242

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GRPEL1-GrpE-like 1, mitochondrial (E. coli) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GRPEL1-GrpE-like 1, mitochondrial (E. coli) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC024242
Product type: DNA & cDNA
Ncbi symbol: GRPEL1
Origin species: Human
Product name: GRPEL1-GrpE-like 1, mitochondrial (E. coli) Gene
Size: 2ug
Accessions: BC024242
Gene id: 80273
Gene description: GrpE-like 1, mitochondrial (E. coli)
Synonyms: GrpE; HMGE; mt-GrpE#1; grpE protein homolog 1, mitochondrial; GrpE-like protein cochaperone; GrpE like 1, mitochondrial
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggctcagtgcgtgaggttggcgcggcgcagtcttcctgctttggcgttgtctctcaggccatctccccggttgttgtgcacagccacgaaacaaaagaacagtggccagaacctggaagaggacatgggtcagagtgaacagaaggcagatcctcctgctacagagaagaccctcctggaagagaaggtcaagttggaggaacagctgaaggagactgtggaaaaatataaacgagctttggcagacactgagaacttacggcagaggagccagaaattggtggaggaggcaaaattatacggcattcaagccttctgcaaggacttgttggaggtggcagacgttctggagaaggcaacacagtgtgttccaaaagaagaaattaaagacgataaccctcacctgaagaacctctatgaggggctggtcatgactgaagtccagatccagaaggtgttcacaaagcatggcttgctcaagttgaaccctgtcggagccaagttcgacccttatgaacatgaggccttgttccacacaccggttgaggggaaggagccaggcacagtggccctagttagcaaagtggggtacaagctgcatgggcgcactctgagacccgccctggtgggggtggtgaaggaagcttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coiled-coil domain containing 109B
- carbonic anhydrase III, muscle specific
- GATA zinc finger domain containing 1
- splicing factor 3b, subunit 3, 130kDa

Reviews

Buy GRPEL1-GrpE-like 1, mitochondrial (E. coli) Gene now

Add to cart