Cart 1 Product Products 115,24 € (empty)
No products
To be determined Shipping
115,24 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 115,24 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 115,24 €
View larger 
MYL6B-myosin, light chain 6B, alkali, smooth muscle and non-muscle Gene
PTXBC012425
New product
Data sheet of MYL6B-myosin, light chain 6B, alkali, smooth muscle and non-muscle Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MYL6B-myosin, light chain 6B, alkali, smooth muscle and non-muscle Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012425 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MYL6B |
| Origin species: | Human |
| Product name: | MYL6B-myosin, light chain 6B, alkali, smooth muscle and non-muscle Gene |
| Size: | 2ug |
| Accessions: | BC012425 |
| Gene id: | 140465 |
| Gene description: | myosin, light chain 6B, alkali, smooth muscle and non-muscle |
| Synonyms: | MLC1SA; myosin light chain 6B; myosin alkali light chain 1 slow a; myosin light chain 1 slow a; myosin light chain 1, slow-twitch muscle A isoform; myosin, light chain 6B, alkali, smooth muscle and non-muscle; myosin, light polypeptide 6B, alkali, smooth muscle and non-muscle; smooth muscle and non-muscle myosin alkali light chain 6B; smooth muscle and nonmuscle myosin light chain alkali 6B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcctcccaagaaggatgttcccgtgaagaaaccagcagggccctccatctccaaacctgctgctaagccagcagcagcaggggctcctccagccaagaccaaagctgagccagctgtcccccaggcccctcagaaaacccaggagcctccagtcgatctctccaaagtggtgatcgagtttaacaaggaccagctggaggagttcaaggaggccttcgagctgtttgaccgagtgggggatggcaagatcctgtacagccagtgtggggacgtgatgagggccctgggccagaaccccaccaacgccgaggtgctcaaggtcctggggaaccccaagagtgatgagctgaagtcgcggcgtgtggactttgagactttcctgcccatgctccaggcagtggccaagaaccgaggccaaggcacatatgaggactacttggaggggtttcgtgtgtttgacaaggaggggaacggcaaagtcatgggagcagagctcagacatgttctcaccacccttggagagaagatgactgaggaggaggtggagaccgttctggcaggacacgaggacagcaacggctgcatcaactacgaggccttcttgaaacacatcctaagcgtttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phosphatidic acid phosphatase type 2 domain containing 1B - eukaryotic translation initiation factor 4E family member 2 - SEC22 vesicle trafficking protein homolog C (S. cerevisiae) - ubiquitin protein ligase E3 component n-recognin 7 (putative) |